Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA_16688 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Rheumatic Heart Disease | ICD-10 | Chronic rheumatic heart diseases (I05-I09) |
DBLink | PMID | 30587718 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | Tissue samples were collected from the removed left atrial appendages of nine adult patients with rheumatic heart disease and persistent AF undergoing mitral valve replacement. Control samples of the left atrial appendages were obtained from organ donors with six normal hearts |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GTCACAAC G CATG CAACA ReverseCTGAAAGGGTTGGGTTCATAG | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Hu, M, Wei, X, Li, M, Tao, L, Wei, L, Zhang, M, Cheng, H, Yuan, Y (2019). Circular RNA expression profiles of persistent atrial fibrillation in patients with rheumatic heart disease. Anatol J Cardiol, 21, 1:2-10. |